Elucidating the Mode of Action of Hybrid Nanoparticles of Cu/Zn against Copper Tolerant Xanthomonas euvesicatoria.

The widespread presence of tolerance to copper in Xanthomonas species has resulted in the need to develop alternative approaches to control plant diseases caused by xanthomonads. In recent years, nanotechnological approaches have resulted in the identification of novel materials to control plant pathogens. While many metal-based nanomaterials have shown promise for disease control, an important question relates to the mode of action of these new materials. In this study we used several approaches such as SEM, propidium monoazide qPCR, epifluorescence microscopy and RNA sequencing to elucidate the mode of action of a Cu/Zn hybrid nanoparticle against copper tolerant strains of Xanthomonas euvesicatoria. We demonstrate that Cu/Zn, unlike Kocide 3000, did not activate copper resistance genes (i.e. copA and copB) in the copper-tolerant bacterium, but functioned by disrupting the bacterial cell structure and perturbing important biological processes such as cell respiration and chemical homeostasis.

Whole-Genome-Sequence-Based Classification of Xanthomonas euvesicatoria pv. eucalypti and Computational Analysis of the Type III Secretion System.

Xanthomonas spp. infect a wide range of annual and perennial plants. Bacterial blight in young seedlings of Eucalyptus spp. in Indonesia was originally identified as X. perforans. However, these strains failed to elicit a hypersensitive response (HR) on either tomatoes or peppers. Two of the strains, EPK43 and BCC 972, when infiltrated into tomato and pepper leaves, failed to grow to significant levels in comparison with well-characterized X. euvesicatoria pv. perforans (Xp) strains. Furthermore, spray inoculation of 'Bonny Best' tomato plants with a bacterial suspension of the Eucalyptus strains resulted in no obvious symptoms. We sequenced the whole genomes of eight strains isolated from two Eucalyptus species between 2007 and 2015. The strains had average nucleotide identities (ANIs) of at least 97.8 with Xp and X. euvesicatoria pv. euvesicatoria (Xeu) strains, both of which are causal agents of bacterial spot of tomatoes and peppers. A comparison of the Eucalyptus strains revealed that the ANI values were >99.99% with each other. Core genome phylogeny clustered all Eucalyptus strains with X. euvesicatoria pv. rosa. They formed separate clades, which included X. euvesicatoria pv. alangii, X. euvesicatoria pv. citrumelonis, and X. euvesicatoria pv. alfalfae. Based on ANI, phylogenetic relationships, and pathogenicity, we designated these Eucalyptus strains as X. euvesicatoria pv. eucalypti (Xee). Comparative analysis of sequenced strains provided unique profiles of type III secretion effectors. Core effector XopD, present in all pathogenic Xp and Xeu strains, was absent in the Xee strains. Comparison of the hrp clusters of Xee, Xp, and Xeu genomes revealed that HrpE in Xee strains was very different from that in Xp and Xeu. To determine if it was functional, we deleted the gene and complemented with the Xee hrpE, confirming it was essential for secretion of type III effectors. HrpE has a hypervariable N-terminus in Xanthomonas spp., in which the N-terminus of Xee strains differs significantly from those of Xeu and Xp strains.

Novel magnesium-copper hybrid nanomaterials for management of bacterial spot of tomato.

Bacterial spot of tomato (BST), predominantly caused by Xanthomonas perforans (Xp) in Florida, is one of the most devastating diseases in hot, humid environments. Bacterial resistance to copper-based bactericides and antibiotics makes disease management extremely challenging. This necessitates alternative solutions to manage the disease. In this study, we used two novel hybrid copper and magnesium nanomaterials noted as magnesium double-coated (Mg-Db) and magnesium-copper (Mg-Cu), to manage BST. In in vitro experiments, no viable cells were recovered following 4 h exposure to 500 µg/ml of both Mg-Db and Mg-Cu, while 100 and 200 µg/ml required 24 h of exposure for complete inhibition. In viability assay using live/dead cell straining method and epifluorescence microscopy, copper tolerant Xp cells were killed within 4 h by both Mg-Cu and Mg-Db nanomaterials at 500 µg/ml, but not by copper hydroxide (Kocide 3000). In the greenhouse, Mg-Db and Mg-Cu at 100-500 µg/ml significantly reduced BST severity compared to micron-sized commercial Cu bactericide Kocide 3000 and the growers' standard (copper hydroxide + mancozeb) (P < 0.05). In field studies, Mg-Db and Mg-Cu nanomaterials significantly reduced disease severity in two out for field trials. Mg-Db at 500 µg/ml reduced BST severity by 34% compared to the non-treated control without affecting yield in Fall, 2020. The use of hybrid nanomaterials at the highest concentrations (500 µg/ml) used in the field experiments can reduce copper use by 90% compared to the growers' standard. In addition, there was no phytotoxicity observed with the use of hybrid nanomaterials in the field. These results suggest the potential of novel magnesium-copper based hybrid nanomaterials to manage copper-tolerant bacterial pathogens.

Unexpected diversity of pseudomonads associated with bacterial leaf spot of cucurbits in the southeastern United States.

Bacterial leaf spot of cucurbits (BLS) is an emerging disease in the southeastern United States which is capable of causing widespread outbreaks under conducive conditions. Historically attributed solely to the bacterium Pseudomonas syringae pv. lachrymans, recent studies have identified additional P. syringae pathovars as causal agents of the disease. To further investigate the identity and diversity of P. syringae strains associated with BLS in the southeastern United States, forty-seven bacterial strains were recovered from symptomatic cucurbits from Florida, Alabama, and Georgia. Strains were characterized using the LOPAT testing scheme, fluorescence, and pathogenicity to watermelon and squash seedlings. Thirty-eight fluorescent strains underwent whole genome sequencing and were further characterized with 16s rRNA, four gene MLSA phylogeny, and average nucleotide identity analysis. Thirty-four isolates were identified as members of the P. syringae species complex, including P. syringae sensu stricto (12), P. alliivorans (12), P. capsici (9), and P. viridiflava (1). An additional four isolates were found to belong to the Pseudomonas genus outside of the syringae species complex, though they did not share 95% or greater average nucleotide identity to any validly published species and are believed to be new species. These results reveal an unpredicted level of diversity of Pseudomonas strains associated with BLS in the region and show the benefits of whole genome sequencing for strain identification. Identification of P. capsici, which is capable of causing disease at higher temperatures than P. syringae, as a causal agent of BLS may also affect management strategies in the future.

Development of a multiplex RT-RPA assay for simultaneous detection of three viruses in cucurbits.

Begomoviruses and criniviruses, vectored by whiteflies (Bemisia tabaci), are important threats to crops worldwide. In recent years, the spread of cucurbit leaf crumple virus (CuLCrV), cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) on cucurbit crops has been reported to cause devastating crop losses in many regions of the world. In this study, a multiplex recombinase polymerase amplification (RPA) assay, an isothermal technique for rapid and simultaneous detection of DNA and RNA viruses CuLCrV, CYSDV and CCYV was developed. Highly specific and sensitive multiplex RPA primers for the coat protein region of these viruses were created and evaluated. The sensitivity of the multiplex RPA assay was examined using serially diluted plasmid containing the target regions. The results demonstrated that multiplex RPA primers have high sensitivity with a detection limit of a single copy of the viruses. The multiplex RPA primers were specific to the target as indicated by testing against other begomoviruses, potyviruses and an ilarvirus, and no nonspecific amplifications were noted. The primers simultaneously detected mixed infection of CCYV, CYSDV and CuLCrV in watermelon and squash crude extracts. This study is the first report of a multiplex RPA assay for simultaneous detection of mixed infection of DNA and RNA plant viruses.

Improved Persistence of Bacteriophage Formulation with Nano N-Acetylcysteine-Zinc Sulfide and Tomato Bacterial Spot Disease Control.

Bacteriophages are biocontrol agents used to manage bacterial diseases. They have long been used against plant pathogenic bacteria; however, several factors impede their use as a reliable disease management strategy. Short-lived persistence on plant surfaces under field conditions results mainly from rapid degradation by exposure to ultraviolet (UV) light. Currently, there are no effective commercial formulations that protect phages from UV. The phage ΦXp06-02-1, which lyses strains of the tomato bacterial spot pathogen Xanthomonas perforans, was mixed with different concentrations of the nanomaterial N-acetylcysteine surface-coated manganese-doped zinc sulfide (NAC-ZnS; 3.5 nm). In vitro, NAC-ZnS at 10,000 µg/ml formulated phage, when exposed to UV for 1 min, provided statistically equivalent plaque-forming unit (PFU) recovery as phages that were not exposed to UV. NAC-ZnS had no negative effect on the phage's ability to lyse bacterial cells under in vitro conditions. NAC-ZnS reduced phage degradation over time in comparison with the nontreated control, whereas N-acetylcysteine-zinc oxide (NAC-ZnO) had no effect. In fluorescent light, without UV exposure, NAC-ZnO-formulated phages were more infective than NAC-ZnS-formulated phages. The nanomaterial-phage mixture did not cause any phytotoxicity when applied to tomato plants. Following exposure to sunlight, the NAC-ZnS formulation improved phage persistence in the phyllosphere by 15 times compared with nonformulated phages. NAC-ZnO-formulated phage populations were undetectable within 32 h, whereas NAC-ZnS-formulated phage populations were detected at 103 PFU/g. At 4 h of sunlight exposure, NAC-ZnS-formulated phages at 1,000 µg/ml significantly reduced tomato bacterial spot disease severity by 16.4% compared with nonformulated phages. These results suggest that NAC-ZnS can be used to improve the efficacy of phages for bacterial diseases.

Potential of Novel Magnesium Nanomaterials to Manage Bacterial Spot Disease of Tomato in Greenhouse and Field Conditions.

Bacterial spot of tomato is among the most economically relevant diseases affecting tomato plants globally. In previous studies, non-formulated magnesium oxide nanoparticles (nano-MgOs) significantly reduced the disease severity in greenhouse and field conditions. However, the aggregation of nano-MgO in liquid suspension makes it challenging to use in field applications. Therefore, we formulated two novel MgO nanomaterials (SgMg #3 and SgMg #2.5) and one MgOH2 nanomaterial (SgMc) and evaluated their physical characteristics, antibacterial properties, and disease reduction abilities. Among the three Mg nanomaterials, SgMc showed the highest efficacy against copper-tolerant strains of Xanthomonas perforans in vitro, and provided disease reduction in the greenhouse experiments compared with commercial Cu bactericide and an untreated control. However, SgMc was not consistently effective in field conditions. To determine the cause of its inconsistent efficacy in different environments, we monitored particle size, zeta potential, morphology, and crystallinity for all three formulated materials and nano-MgOs. The MgO particle size was determined by the scanning electron microscopy (SEM) and dynamic light scattering (DLS) techniques. An X-ray diffraction (XRD) study confirmed a change in the crystallinity of MgO from a periclase to an Mg(OH)2 brucite crystal structure. As a result, the bactericidal activity correlated with the high crystallinity present in nano-MgOs and SgMc, while the inconsistent antimicrobial potency of SgMg #3 and SgMg #2.5 might have been related to loss of crystallinity. Future studies are needed to determine which specific variables impair the performance of these nanomaterials in the field compared to under greenhouse conditions. Although SgMc did not lead to significant disease severity reduction in the field, it still has the potential to act as an alternative to Cu against bacterial spot disease in tomato transplant production.

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Non-coding deep learning models for tomato biotic and abiotic stress classification using microscopic images.

Plant disease classification is quite complex and, in most cases, requires trained plant pathologists and sophisticated labs to accurately determine the cause. Our group for the first time used microscopic images (×30) of tomato plant diseases, for which representative plant samples were diagnostically validated to classify disease symptoms using non-coding deep learning platforms (NCDL). The mean F1 scores (SD) of the NCDL platforms were 98.5 (1.6) for Amazon Rekognition Custom Label, 93.9 (2.5) for Clarifai, 91.6 (3.9) for Teachable Machine, 95.0 (1.9) for Google AutoML Vision, and 97.5 (2.7) for Microsoft Azure Custom Vision. The accuracy of the NCDL platform for Amazon Rekognition Custom Label was 99.8% (0.2), for Clarifai 98.7% (0.5), for Teachable Machine 98.3% (0.4), for Google AutoML Vision 98.9% (0.6), and for Apple CreateML 87.3 (4.3). Upon external validation, the model's accuracy of the tested NCDL platforms dropped no more than 7%. The potential future use for these models includes the development of mobile- and web-based applications for the classification of plant diseases and integration with a disease management advisory system. The NCDL models also have the potential to improve the early triage of symptomatic plant samples into classes that may save time in diagnostic lab sample processing.

Pseudomonas californiensis sp. nov. and Pseudomonas quasicaspiana sp. nov., isolated from ornamental crops in California.

Five bacterial strains were isolated from symptomatic leaves of Achillea millefolium, Delphinium sp. and Hydrangea sp. in California. Colonies isolated on King's medium B (KMB) appeared white, mucoid and round, similar to Pseudomonas species. Phylogenetic analyses based on 16S rRNA, rpoB, rpoD and gyrB genes placed the bacteria into three distinct groups within Pseudomonas that were most closely related to Pseudomonas viridiflava, Pseudomonas cichorii or Pseudomonas caspiana. To further characterize the strains, phenotypic analyses and the following tests were performed: fatty acid methyl ester composition, LOPAT, fluorescence on KMB, Biolog assay, and transmission electron microscopy. Finally, whole genome sequencing of the strains was conducted, and the sequences were compared with reference genomes of Pseudomonas species based on average nucleotide identity (ANI). The first group, which consists of three strains isolated from delphinium, hydrangea and achillea, had 95.6-96.9 % pairwise ANI between each other; the second group consists of two strains isolated from delphinium that had 100 % pairwise ANI. Although comparisons of the two groups with publicly available genomes revealed closest relationships with P. viridiflava (91.6 %), P. caspiana (88.3 %) and P. asturiensis (86.7 %), ANI values were less than 95 % compared to all validly published pseudomonads. Combining genomic and phenotypic data, we conclude that these strains represent two new species and the names proposed are Pseudomonas quasicaspiana sp. nov. (type strain DSMZ 11 30 42T=LMG 32 434T) for the strains isolated from delphinium, achillea and hydrangea and Pseudomonas californiensis sp. nov. (DSMZ 11 30 43T=LMG 32 432T) for the two strains isolated from delphinium. The specific epithets quasicaspiana and californiensis were selected based on the close phylogenetic relationship of strains with P. caspiana and on the geographic location of isolation, respectively.

Draft genome sequences of Pseudomonas amygdali pv. loropetali pathotype strain DSM 105780 PT, isolated from Florida.

The pathogen that causes stem gall in Loropetalum chinense was first identified in Florida and Alabama in 2018 and named Pseudomonas amygdali pv. loropetali. We report the genome sequence of the pathotype strain of this pathogen, Pseudomonas amygdali pv. loropetali DSM105780 PT.

Future of Bacterial Disease Management in Crop Production.

Bacterial diseases are a constant threat to crop production globally. Current management strategies rely on an array of tactics, including improved cultural practices; application of bactericides, plant activators, and biocontrol agents; and use of resistant varieties when available. However, effective management remains a challenge, as the longevity of deployed tactics is threatened by constantly changing bacterial populations. Increased scrutiny of the impact of pesticides on human and environmental health underscores the need for alternative solutions that are durable, sustainable, accessible to farmers, and environmentally friendly. In this review, we discuss the strengths and shortcomings of existing practices and dissect recent advances that may shape the future of bacterial disease management. We conclude that disease resistance through genome modification may be the most effective arsenal against bacterial diseases. Nonetheless, more research is necessary for developing novel bacterial disease management tactics to meet the food demand of a growing global population.

Temporal Incidence of Eriophyid Mites on Rose Rosette Disease-Symptomatic and -Asymptomatic Roses in Central Georgia, USA.

Phyllocoptes fructiphilus Keifer (Acari: Eriophyidae) is the vector of rose rosette virus (RRV), which causes rose rosette disease (RRD) in North America. The RRD symptoms, such as witches' broom, flower, and leaf deformation, disrupt the aesthetic appearance of plants and cause plant mortality. Because there is no cure for RRV, it is critical to manage the vector and reduce the spread of the virus. The information on the phenology of P. fructiphilus on rose plants is essential to develop management strategies and reduce its spread. Thus, the objectives of the study were to determine 1) the phenology of eriophyid mites (including P. fructiphilus) in central Georgia due to its widespread occurrence in the state and 2) the incidence of eriophyid mites on closed and opened flower buds and other plant parts. In central Georgia, eriophyid mites, including P. fructiphilus were active on both symptomatic and asymptomatic plants from April to December. The mite densities were greater during July and August than during the remaining months on asymptomatic plants. The mites were more abundant on the RRD-symptomatic than on the asymptomatic plants. Similar numbers of eriophyid mites were observed on closed and opened flower buds. Eriophyid mite densities were greater on sepals and leaf bases than on other plant parts.

Impact of Foliar Application of Acibenzolar-S-Methyl on Rose Rosette Disease and Rose Plant Quality.

Rose rosette disease (RRD) caused by rose rosette emaravirus (RRV) is a major issue in the U.S. rose industry with no effective method for its management. This study evaluated the effect of foliar application of acibenzolar-S-methyl (ASM), a plant systemic acquired resistance inducer, in reducing RRD disease severity on Rosa species cv. Radtkopink ('Pink Double Knock Out') under greenhouse conditions, and the effect of ASM on plant growth under commercial nursery production conditions. ASM at 50- or 100-mg/liter concentrations at weekly intervals significantly reduced RRD severity compared with the untreated control in two of the three greenhouse trials (P < 0.05). The plants in these trials were subsequently pruned and observed for symptoms, which further indicated that application of ASM at 50- or 100-mg/liter concentrations lowered disease severity compared with the untreated control (P < 0.05) in these two trials. Plants treated with ASM at 50- or 100-mg/liter concentrations had delayed incidence of RRD compared with the nontreated controls. Plants treated with ASM at the 50- or 100-mg/liter rate in all three trials either did not have RRV present or the virus was present in fewer leaf samples than untreated controls as indicated by quantitative reverse transcription PCR analysis. Overall, plants treated with ASM at the 50-mg/liter concentration had 36 to 43% reduced RRD incidence compared with the water control. The treatment of two cultivars of rose, 'Radtkopink' and 'Meijocos' ('Pink Drift'), with weekly foliar applications of ASM at the three rates (0.5, 0.75, and 1.0 oz/A) indicated that ASM had no negative effect on flowering or plant growth at even the highest rate of application.

A centenary for bacterial spot of tomato and pepper.

DISEASE SYMPTOMS: Symptoms include water-soaked areas surrounded by chlorosis turning into necrotic spots on all aerial parts of plants. On tomato fruits, small, water-soaked, or slightly raised pale-green spots with greenish-white halos are formed, ultimately becoming dark brown and slightly sunken with a scabby or wart-like surface. HOST RANGE: Main and economically important hosts include different types of tomatoes and peppers. Alternative solanaceous and nonsolanaceous hosts include Datura spp., Hyoscyamus spp., Lycium spp., Nicotiana rustica, Physalis spp., Solanum spp., Amaranthus lividus, Emilia fosbergii, Euphorbia heterophylla, Nicandra physaloides, Physalis pubescens, Sida glomerata, and Solanum americanum. TAXONOMIC STATUS OF THE PATHOGEN: Domain, Bacteria; phylum, Proteobacteria; class, Gammaproteobacteria; order, Xanthomonadales; family, Xanthomonadaceae; genus, Xanthomonas; species, X. euvesicatoria, X. hortorum, X. vesicatoria. SYNONYMS (NONPREFERRED SCIENTIFIC NAMES): Bacterium exitiosum, Bacterium vesicatorium, Phytomonas exitiosa, Phytomonas vesicatoria, Pseudomonas exitiosa, Pseudomonas gardneri, Pseudomonas vesicatoria, Xanthomonas axonopodis pv. vesicatoria, Xanthomonas campestris pv. vesicatoria, Xanthomonas cynarae pv. gardneri, Xanthomonas gardneri, Xanthomonas perforans. MICROBIOLOGICAL PROPERTIES: Colonies are gram-negative, oxidase-negative, and catalase-positive and have oxidative metabolism. Pale-yellow domed circular colonies of 1-2 mm in diameter grow on general culture media. DISTRIBUTION: The bacteria are widespread in Africa, Brazil, Canada and the USA, Australia, eastern Europe, and south-east Asia. Occurrence in western Europe is restricted. PHYTOSANITARY CATEGORIZATION: A2 no. 157, EU Annex designation II/A2. EPPO CODES: XANTEU, XANTGA, XANTPF, XANTVE.

First Report of Cucurbit Chlorotic Yellows Virus affecting Watermelon in USA.

Watermelon (Citrullus lanatus) is a high nutrient crop, high in vitamins and very popular in the U.S and globally. The crop was harvested from 101,800 acres with a value of $560 million in the U.S (USDA-NASS, 2020). California, Florida, Georgia and Texas are the four-leading watermelon-producing states in the U.S. During the fall season of 2020, plants in two North Florida watermelon fields, one in Levy County (~20 acres) and one in Suwannee County (~80 acres) with varieties Talca and Troubadour, respectively, exhibited viral-like symptoms. The fields had 100% disease incidence that led to fruit quality issues and yield losses of 80% and above. Symptoms observed in the watermelon samples included leaf crumpling, yellowing and curling, and vein yellowing similar to that of single/and or mixed infection of cucurbit leaf crumple virus (CuLCrV; genus: Begomovirus, family: Geminiviridae), cucurbit yellow stunting disorder virus (CYSDV; genus: Crinivirus, family: Closteroviridae) and squash vein yellowing virus (SqVYV; genus: Ipomovirus, family: Potyviridae), although the vine decline symptoms often associated with SqVYV infection of watermelon were not observed. All three viruses are vectored by whiteflies and previously described in Florida (Akad et al., 2008; Polston et al., 2008; Adkins et al., 2009). To confirm the presence of these viruses, RNA was isolated from 20 symptomatic samples using the RNeasy Plant Mini Kit (Qiagen, USA) as per protocol. This was followed by RT-PCR (NEB, USA) using gene-specific primers described for CuLCrV, CYSDV and SqVYV (Adkins et al., 2009). Amplicons of expected sizes were obtained for all the viruses with the infection of CuLCrV in 17/20, CYSDV in 16/20, and SqVYV in 8/20 samples. In addition, the presence of cucurbit chlorotic yellows virus (CCYV; genus: Crinivirus, family: Closteroviridae) in mixed infection was confirmed in 4/20 samples (3 leaves and 1 fruit) by RT-PCR with primers specific to the CCYV coat protein (CP), heat shock protein 70 homolog (HSP70h) and RNA dependent RNA polymerase (RdRp) designed based on the available CCYV sequences (Sup Table. 1). The RT-PCR amplification was performed using a symptomatic watermelon sample and the amplicons of RdRp, HSP70h and CP were directly sequenced by Sanger method, and the sequences of the amplicons were deposited in GenBank under the accession number: MW527462 (RdRp, 952 bp), MW527461 (HSP70h, 583 bp) and MW527460 (CP, 852 bp). BLASTn analysis demonstrated that the sequences exhibited an identity of 99% to 100% (RdRp and HSP70h, 100%; and CP, 99%) with the corresponding regions of the CCYV isolate Shanghai from China (accession number: KY400636 and KY400633). The presence of CCYV was further confirmed in the watermelon samples by ELISA (Loewe, Germany) using crude sap extracted from the RT-PCR-positive, symptomatic watermelon samples. CCYV was first identified in Kumamoto, Japan in 2004 on melon plants (Gyoutoku et al. 2009). The CCYV was previously reported on melon from Imperial Valley, California (Wintermantel et al., 2019), and more recently on squash in Tifton, Georgia (Kavalappara et al., 2021) and cantaloupe in Cameron, Texas (Hernandez et al., 2021). To our knowledge, this is the first report of CCYV on field watermelon production in the U.S. Continued monitoring of the CCYV in spring and fall watermelon crop, and cucurbit volunteers and weeds will be critical toward understanding the spread of this virus and its potential risk to watermelon in Florida and other regions of the U.S.

Magnesium Oxide Nanomaterial, an Alternative for Commercial Copper Bactericides: Field-Scale Tomato Bacterial Spot Disease Management and Total and Bioavailable Metal Accumulation in Soil.

Copper (Cu) is the most extensively used bactericide worldwide in many agricultural production systems. However, intensive application of Cu bactericide have increased the selection pressure toward Cu-tolerant pathogens, including Xanthomonas perforans, the causal agent of tomato bacterial spot. However, alternatives for Cu bactericides are limited and have many drawbacks including plant damage and inconsistent effectiveness under field conditions. Also, potential ecological risk on nontarget organisms exposed to field runoff containing Cu is high. However, due to lack of alternatives for Cu, it is still widely used in tomato and other crops around the world in both conventional and organic production systems. In this study, a Cu-tolerant X. perforans strain GEV485, which can tolerate eight tested commercial Cu bactericides, was used in all the field trials to evaluate the efficacy of MgO nanomaterial. Four field experiments were conducted to evaluate the impact of intensive application of MgO nanomaterial on tomato bacterial spot disease severity, and one field experiment was conducted to study the impact of soil accumulation of total and bioavailable Cu, Mg, Mn, and Zn. In the first two field experiments, twice-weekly applications of 200 µg/mL MgO significantly reduced disease severity by 29-38% less in comparison to a conventional Cu bactericide Kocide 3000 and 19-30% less in comparison to the water control applied at the same frequency (p = 0.05). The disease severity on MgO twice-weekly was 12-32% less than Kocide 3000 + Mancozeb treatment. Single weekly applications of MgO had 13-19% higher disease severity than twice weekly application of MgO. In the second set of two field trials, twice-weekly applications of MgO at 1000 µg/mL significantly reduced disease severity by 32-40% in comparison to water control applied at the same frequency (p = 0.05). There was no negative yield impact in any of the trials. The third field experiment demonstrated that application of MgO did not result in significant accumulation of total and bioavailable Mg, Mn, Cu, or Zn in the root-associated soil and in soil farther away from the production bed compared to the water control. However, Cu bactericide contributed to significantly higher Mn, Cu, and Zn accumulation in the soil compared to water control (p = 0.05). This study demonstrates that MgO nanomaterial could be an alternative for Cu bactericide and have potential in reducing risks associated with development of tolerant strains and for reducing Cu load in the environment.

Phylogenetic and phenotypic characterization of Fusarium oxysporum f. sp. niveum isolates from Florida-grown watermelon.

Fusarium wilt of watermelon (Citrullus lanatus) caused by Fusarium oxysporum f. sp. niveum (Fon), has become an increasing concern of farmers in the southeastern USA, especially in Florida. Management of this disease, most often through the use of resistant cultivars and crop rotation, requires an accurate understanding of an area's pathogen population structure and phenotypic characteristics. This study improved the understanding of the state's pathogen population by completing multilocus sequence analysis (MLSA) of two housekeeping genes (BT and TEF) and two loci (ITS and IGS), aggressiveness and race-determining bioassays on 72 isolates collected between 2011 and 2015 from major watermelon production areas in North, Central, and South Florida. Multilocus sequence analysis (MLSA) failed to group race 3 isolates into a single large clade; moreover, clade membership was not apparently correlated with aggressiveness (which varied both within and between clades), and only slightly with sampling location. The failure of multilocus sequence analysis using four highly conserved housekeeping genes and loci to clearly group and delineate known Fon races provides justification for future whole genome sequencing efforts whose more robust genomic comparisons will provide higher resolution of intra-species genetic distinctions. Consequently, these results suggest that identification of Fon isolates by race determination alone may fail to detect economically important phenotypic characteristics such as aggressiveness leading to inaccurate risk assessment.

Copper-fixed quat: a hybrid nanoparticle for application as a locally systemic pesticide (LSP) to manage bacterial spot disease of tomato.

The development of bacterial tolerance against pesticides poses a serious threat to the sustainability of food production. Widespread use of copper (Cu)-based products for plant disease management has led to the emergence of copper-tolerant pathogens such as Xanthomonas perforans (X. perforans) strains in Florida, which is very destructive to the tomato (Solanum lycopersicum) industry. In this study, we report a hybrid nanoparticle (NP)-based system, coined Locally Systemic Pesticide (LSP), which has been designed for improved efficacy compared to conventional Cu-based bactericides against Cu-tolerant X. perforans. The silica core-shell structure of LSP particles makes it possible to host ultra-small Cu NPs (<10 nm) and quaternary ammonium (Quat) molecules on the shell. The morphology, release of Cu and Quat, and subsequent in vitro antimicrobial properties were characterized for LSP NPs with core diameters from 50 to 600 nm. A concentration of 4 µg mL-1 (Cu): 1 µg mL-1 (Quat) was found to be sufficient to inhibit the growth of Cu-tolerant X. perforans compared to 100 µg mL-1 (metallic Cu) required with standard Kocide 3000. Wetting properties of LSP exhibited contact angles below 60°, which constitutes a significant improvement from the 90° and 85° observed with water and Kocide 3000, respectively. The design was also found to provide slow Cu release to the leaves upon water washes, and to mitigate the phytotoxicity of water-soluble Cu and Quat agents. With Cu and Quat bound to the LSP silica core-shell structure, no sign of phytotoxicity was observed even at 1000 µg mL-1 (Cu). In greenhouse and field experiments, LSP formulations significantly reduced the severity of bacterial spot disease compared to the water control. Overall, the study highlights the potential of using LSP particles as a candidate for managing tomato bacterial spot disease and beyond.

First Report of Bacterial Wilt Disease of Tomato, Pepper and Gboma Caused by the Ralstonia solanacearum Species Complex in Togo.

Tomato (Solanum lycopersicum), pepper (Capsicum annum), and gboma (Solanum macrocarpon) are major vegetables in Togo, with many people depending on these crops for their livelihood. In December 2018, during the dry season with temperatures between 21°C to 35°C, tomato ('Petomech'), pepper ('Gboyebesse') and gboma (local landrace) showing wilt symptoms without foliar yellowing were collected from two locations, Tchouloum and CECO-AGRO sites in the Sotouboua Prefecture of Togo, ~300 km from the capital city of Lome. Disease incidence ranged between 10% to 50% in multiple fields. Cut stems of most wilting tomato, pepper and gboma plants produced bacterial ooze in water and vascular discoloration was visible in longitudinal stem sections. Ground cut stem tissue tested positive with Rs ImmunoStrips specific to the Ralstonia solanacearum species complex (RSSC) (Agdia Inc., Elkhart, IN, USA). Collected samples were stored at ambient temperature and cultured within 36 hr. Culturing sap from cut stems plated on modified SMSA medium (Engelbrecht 1994) yielded colonies with typical RSSC morphology: slow-growing, irregular, mucoid, and white with red centers. Genomic DNA was extracted from thirteen isolates: two from gboma, five from tomato and six from pepper. The expected 280-bp band was amplified from all 13 genomic DNAs following polymerase chain reaction (PCR) using the 759/760 RSSC-specific primer pair (Opina et al. 1997). PCR with the 630/631 primers, which identify the Race 3 biovar 2 RSSC subgroup, did not yield a product from any Togo isolate (Opina et al. 1997). The phylotype multiplex PCR identified all Togo isolates as belonging to the phylotype I subgroup, also called R. pseudosolanacearum (Prior et al. 2016; Fegan and Prior 2005). Phylotype control DNAs were from strains GMI1000 (phylotype I, Asia), K60 (phylotype II, Americas), CMR15 (phylotype III, Africa), and PSI07 (phylotype IV, Indondesia). Comparative genomic analysis of the partial endoglucanase (egl) gene, amplified with the Endo primer pairs (Poussier et al. 2000), revealed all Togo strains belonged to sequevar 17, a group known to cause bacterial wilt of peanut in China. (Xu et al. 2009). The egl sequences are in NCBI GenBank accessions MT572393 to MT572405. Koch's postulates were completed by inoculating 28-day-old bacterial wilt-susceptible 'Bonny Best' tomato plants by soil soak (Khokhani et al. 2018). Briefly, soil around each unwounded plant was drenched with 50 ml of a 108 CFU/mL suspension of bacteria grown from a single colony. Five plants were inoculated with each of four randomly selected Togo strains. RSSC phylotype I strain GMI1000 served as a positive control and water treated plants as negative controls. Plants were kept in a 28°C growth chamber with a 12 hr photoperiod. All RSSC inoculated plants were fully wilted within a week; symptoms resembled to those observed in the field. Water treated control plants did not wilt. Culturing sap from all inoculated plants on SMSA medium yielded colonies with typical RSSC morphology that tested positive with the Rs ImmunoStrips. This is the first identification of RSSC in Togo. These results will guide development of disease management strategies and regionally appropriate breeding of vegetable lines with resistance to the phylotype I RSSC strains present in Togo.